posted on 2023-03-31, 18:04authored byYvette S. Levray, Bianca Bana, Sarah J. Tarr, Emilia J. McLaughlin, Peter Rossi-Smith, Anita Waltho, Georgina H. Charlton, Riccardo Zenezini Chiozzi, Colin R. Straton, Konstantinos Thalassinos, Andrew R. Osborne
(A) Diagram of the unmodified pfs47 gene locus, a plasmid containing a GFP1-10 expression cassette, and the pfs47 locus modified with a GFP1-10 expression cassette. The position targeted by the gRNA within the pfs47 gene, regions of homology between the pfs47 locus and the repair plasmid, and binding sites for primer 1 and primer 2 used for PCR analysis are shown. (B) PCR analysis of parasites with GFP1-10 expression cassettes integrated into the pfs47 gene locus. PCR reactions were performed using genomic DNA from cloned parasites and primers 1 and 2 (taattgcatacacataaatatttgtgttgtac and ggagataaatgtaaggtaaatatacacaaac) and analysed using an ethidium bromide stained agarose gel.