Expression and replication of Mutant 1 HBV in transgenic mice.

(A) Map of the HBV surface gene, with the 3 initiation codons for the 3 forms of surface protein indicated by asterisks. Also shown are PreS1, S, and X RNA transcripts from HBV. Mutant 1 contains a missense mutation of the preS2 start codon and a 54-bp deletion (marked as Δ2) corresponding to codons 4 through 21 in the preS2 region. (B) Primer extension analysis [28] of the preS1 and S transcripts in the liver of Mutant 1 mice, compared to Tg05 wildtype HBV mice. Note that the S transcript products are smaller in the Mutant 1 mice, because of the deletion between the primer and the mRNA start sites [28], and the pattern of start sites is also different from that in wildtype HBV mice, since the deletion extends slightly into the initiation region of the S transcripts[19]. (C) Western blotting of the large and small surface proteins in the liver of Mutant 1 and wildtype HBV mice. LS and SS, large and small surface protein respectively. Each protein has 2 forms, differing in the glycosylation. Note that the large surface protein is smaller in the Mutant 1 mice, because of the deletion in the preS2 region. In the top part, the samples were separated on a 10% polyacrylamide gel, while in the bottom part, the samples were separated on a 12% gel. (D) PCR detection of circulating HBV [13] in the serum of Mutant 1 mice (lanes 1 and 4), compared to wildtype HBV mice (lanes 3 and 5). For lanes 1-3, the primers (5′ATATTGCCTCTCACATCTCGTCAATCTC and 5′AGCGGTATAAAGGGACTCACGATGCTGT) bracketed nucleotides 101 to 800 in the surface gene, downstream of the deletion. For lanes 4–5, the primers bracketed the deletion in the preS2 region [21]. (E) HBV titers in Mutant 1 and wildtype HBV transgenic mice. The amount of HBV genomic DNA in serum of mice at 2-3 months of age is determined by qPCR. The viral titer in wildtype HBV transgenic mice (Tg05) is significantly higher than that in both Mutant 1 Line 4 and Line 7 mice (P<0.02).