Materials used in the mutagenesis process for creating plasmids with two Lac repressor binding sites.

Primer sequences(5′→3′):

Mut0: ctaactcacattaattgcgttgAgctcGAGgTTcgctttccagtc.

Mut1: catacgagccggaa (G) cataaagtgtaaagc.

Mut2: ctcggaaagaaca AATTGTGAGCGCTCACAATT aaggccaggaacc.

Mut3: ctcggaaagaacat AATTGTGAGCGCTCACAATT aggccaggaaccg.

Mut4: cggaaagaacatg AATTGTGAGCGCTCACAATT ggccaggaaccgt.

Mut5: ggaaagaacatgt AATTGTGAGCGCTCACAATT gccaggaaccgta.

Mut6: gaaagaacatgtg AATTGTGAGCGCTCACAATT ccaggaaccgtaa.

Mut7: cggaaagaacatgtga AATTGTGAGCGCTCACAATT caggaaccgtaaaaag.

Mut8: ggaaagaacatgtgag AATTGTGAGCGCTCACAATT aggaaccgtaaaaagg.

Mut9: gaaagaacatgtgagc AATTGTGAGCGCTCACAATT ggaaccgtaaaaaggc.

Mut10: catacgagccggaag [C] cataaagtgtaaagc.

Mut11: catacgagccggaag [CG] cataaagtgtaaagc.

The capital letters in the primer sequences indicate the mutations. ‘()’ indicates bp deletion and ‘[ ]’ indicates bp addition. The inter-operator distance indicated here is the distance between two inner edges of the operators instead of center to center distance that is commonly used in in vivo experiments [11][13], [86], [93].