10.1371/journal.pone.0026240.g001 Bing Na Bing Na Zhiming Huang Zhiming Huang Qian Wang Qian Wang Zhongxia Qi Zhongxia Qi Yongjun Tian Yongjun Tian Cheng-Chan Lu Cheng-Chan Lu Jingwei Yu Jingwei Yu Martha A. Hanes Martha A. Hanes Sanjay Kakar Sanjay Kakar Eric J. Huang Eric J. Huang J.-H. James Ou J.-H. James Ou Limin Liu Limin Liu T. S. Benedict Yen T. S. Benedict Yen Expression and replication of Mutant 1 HBV in transgenic mice. Public Library of Science 2011 replication mutant hbv transgenic 2011-10-12 01:40:59 Figure https://plos.figshare.com/articles/figure/_Expression_and_replication_of_Mutant_1_HBV_in_transgenic_mice_/396059 <p>(<b>A</b>) Map of the HBV surface gene, with the 3 initiation codons for the 3 forms of surface protein indicated by asterisks. Also shown are PreS1, S, and X RNA transcripts from HBV. Mutant 1 contains a missense mutation of the preS2 start codon and a 54-bp deletion (marked as Δ2) corresponding to codons 4 through 21 in the preS2 region. (<b>B</b>) Primer extension analysis <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0026240#pone.0026240-Xu3" target="_blank">[28]</a> of the preS1 and S transcripts in the liver of Mutant 1 mice, compared to Tg05 wildtype HBV mice. Note that the S transcript products are smaller in the Mutant 1 mice, because of the deletion between the primer and the mRNA start sites <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0026240#pone.0026240-Xu3" target="_blank">[28]</a>, and the pattern of start sites is also different from that in wildtype HBV mice, since the deletion extends slightly into the initiation region of the S transcripts<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0026240#pone.0026240-Fan2" target="_blank">[19]</a>. (<b>C</b>) Western blotting of the large and small surface proteins in the liver of Mutant 1 and wildtype HBV mice. LS and SS, large and small surface protein respectively. Each protein has 2 forms, differing in the glycosylation. Note that the large surface protein is smaller in the Mutant 1 mice, because of the deletion in the preS2 region. In the top part, the samples were separated on a 10% polyacrylamide gel, while in the bottom part, the samples were separated on a 12% gel. (<b>D</b>) PCR detection of circulating HBV <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0026240#pone.0026240-Guidotti1" target="_blank">[13]</a> in the serum of Mutant 1 mice (lanes 1 and 4), compared to wildtype HBV mice (lanes 3 and 5). For lanes 1-3, the primers (5′ATATTGCCTCTCACATCTCGTCAATCTC and 5′AGCGGTATAAAGGGACTCACGATGCTGT) bracketed nucleotides 101 to 800 in the surface gene, downstream of the deletion. For lanes 4–5, the primers bracketed the deletion in the preS2 region <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0026240#pone.0026240-Raimondo1" target="_blank">[21]</a>. (<b>E</b>) HBV titers in Mutant 1 and wildtype HBV transgenic mice. The amount of HBV genomic DNA in serum of mice at 2-3 months of age is determined by qPCR. The viral titer in wildtype HBV transgenic mice (Tg05) is significantly higher than that in both Mutant 1 Line 4 and Line 7 mice (P<0.02).</p>